| Publicaties | Instituten | Personen | Datasets | Projecten | Kaarten | ||||
Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Citatie
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4 https://doi.org/10.15468/ulq7je
Contact:
Tytgat, Bjorn Beschikbaarheid:
 Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.Beschrijving
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. meer
Geographic coverage: Sor Ronda Mountains, East Antarctica Taxonomic coverage: 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8-27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536-516). Scope Thema's: Biologie > Organisch (& bio-) chemie Kernwoorden: Terrestrisch, Bodem, Metadata, Sequencing, Antarctica, Bacteria Geografische spreiding Antarctica [Marine Regions] Spreiding in de tijd
1 Januari 2009 - 1 Januari 2010 Taxonomic coverage
Bacteria [WoRMS]
Parameter
Moleculaire data Bijdrage door
Universiteit Gent (UGent), meer, data creator
Gerelateerde datasets
Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2018-12-04
Informatie laatst gewijzigd: 2019-04-10
| ||||
