IMIS

Study Extent: Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)

Quality Control: Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Method step description:

1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.