IMIS | Vlaams Instituut voor de Zee
 

Vlaams Instituut voor de Zee

Platform voor marien onderzoek

IMIS

Publicaties | Instituten | Personen | Datasets | Projecten | Kaarten
[ meld een fout in dit record ] Print deze pagina

Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Citatie
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4 https://doi.org/10.15468/ulq7je
Contact: Tytgat, Bjorn

Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.

Beschrijving
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. meer

Geographic coverage: Sor Ronda Mountains, East Antarctica
Taxonomic coverage: 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8-27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536-516).

Scope
Thema's:
Biologie > Organisch (& bio-) chemie
Kernwoorden:
Bodem, Metadata, Sequencing, Antarctica, Bacteria

Geografische spreiding
Antarctica [Marine Regions]

Spreiding in de tijd
1 Januari 2009 - 1 Januari 2010

Taxonomische spreiding
Bacteria [WoRMS]

Parameter
Moleculaire data

Bijdrage door
Universiteit Gent (UGent), meerdata creator

Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biogeographic Information System, meer

Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2018-12-04
Informatie laatst gewijzigd: 2019-04-10
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid